Biochemistry生物化学.pptVIP

Biochemistry Xiong Xiong 2009.09 Course Introduction Instructor: Xiong xiong Class: lecture, seminar/colloquium, discussion Duration: 08/09/09 – 10/12/09 Days/Times: T, 8:00-9:40am; Th, 8:00-9:40am Credit hours: 56 Credits: 3.5 Final grades: Contact: libaitian7@ Introduction I. The Molecular Design of Life II. Transducing and Storing Energy III. Synthesizing the Molecules of Life IV. Responding to Environmental Changes Biochemistry and the Genomic Revolution GACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAG This string of letters A, C, G, and T is a part of a DNA sequence. DNA Illustrates the Relation between Form and Function DNA Is Constructed from Four Building Blocks Two Single Strands of DNA Combine to Form a Double Helix The Double Helix. The double-helical structure of DNA proposed by Watson and Crick. The sugar-phosphate backbones of the two chains are shown in red and blue and the bases are shown in green, purple, orange, and yellow. DNA Replication. If a DNA molecule is separated into two strands, each strand can act as the template for the generation of its partner strand RNA Is an Intermediate in the Flow of Genetic Information Proteins, Encoded by Nucleic Acids, Perform Most Cell Functions Folding of a Protein. The three-dimensional structure of a protein, a linear polymer of amino acids, is dictated by its amino acid sequence. Biochemical Unity Underlies Biological Diversity The Diversity of Living Systems. The distinct morphologies of the three organisms shown-a plant (the false hellebora, or Indian poke) and two animals (sea urchins and a common house cat)-might suggest that they have little in common. Yet biochemically they display a remarkable commonality that attests to a common ancestry. [(Left and right) John Dudak/Phototake. (Middle) Jeffrey L. Rotman/Peter Arnold.] Chemical Bonds