Biotech2.ppt.pptVIP

* * Taq = Thermus aquaticus (an Archaebactera) Highly thermostable – withstands temperatures up to 95°C for more than 40min. BTW, Taq is patented by Roche and is very expensive. Its usually the largest consumable expense in a genomics lab. I’ve heard stories of blackmarket Taq clones, so scientists could grow up their own bacteria to produce Taq in the lab. It’s like pirated software -- pirated genes! More Basic Biotechnology Tools Sorting Copying DNA Many uses of restriction enzymes… Now that we can cut DNA with restriction enzymes… we can cut up DNA from different people… or different organisms… and compare it Comparing cut up DNA How do we compare DNA fragments? separate fragments by size How do we separate DNA fragments? run it through a gelatin agarose made from algae gel electrophoresis Gel electrophoresis separattes DNA using an electrical field DNA is negatively charged moves toward the positive side + – DNA ? ? ? ? ? ? ? ? “swimming through Jello” DNA moves in an electrical field… size of DNA fragment affects how far it travels small pieces travel farther large pieces travel slower lag behind Gel electrophoresis + – DNA ? ? ? ? ? ? ? “swimming through Jello” Running a gel 1 2 cut DNA with restriction enzymes fragments of DNAseparate out based on size 3 Stain DNA ethidium bromide binds to DNA fluoresces under UV light Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships – + DNA ? 1 3 2 4 5 1 2 3 4 5 turtle snake rat squirrel fruitfly Uses: Forensics Comparing DNA sample from crime scene with suspects victim – + S1 DNA ? S2 S3 V suspects crime scene sample Allele 1 GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA repeats DNA patterns for DNA fingerprints cut sites cut sites GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 3 DNA ? – + allele 1 Cut the DNA RFLPs Restriction Fragment Length Polymorphism differences i